ID: 1149063535

View in Genome Browser
Species Human (GRCh38)
Location 17:52453178-52453200
Sequence GAACCTACCAGGAAATGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149063535_1149063540 -7 Left 1149063535 17:52453178-52453200 CCACCCCATTTCCTGGTAGGTTC No data
Right 1149063540 17:52453194-52453216 TAGGTTCTTCTCTGTATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149063535 Original CRISPR GAACCTACCAGGAAATGGGG TGG (reversed) Intergenic
No off target data available for this crispr