ID: 1149072423

View in Genome Browser
Species Human (GRCh38)
Location 17:52558423-52558445
Sequence ATATTTGAGCCCCCAAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149072422_1149072423 -7 Left 1149072422 17:52558407-52558429 CCAGGTCTTGATGAGAATATTTG No data
Right 1149072423 17:52558423-52558445 ATATTTGAGCCCCCAAATCCAGG No data
1149072421_1149072423 10 Left 1149072421 17:52558390-52558412 CCAGGAGGGGCAAGATACCAGGT No data
Right 1149072423 17:52558423-52558445 ATATTTGAGCCCCCAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149072423 Original CRISPR ATATTTGAGCCCCCAAATCC AGG Intergenic