ID: 1149072423 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:52558423-52558445 |
Sequence | ATATTTGAGCCCCCAAATCC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1149072422_1149072423 | -7 | Left | 1149072422 | 17:52558407-52558429 | CCAGGTCTTGATGAGAATATTTG | No data | ||
Right | 1149072423 | 17:52558423-52558445 | ATATTTGAGCCCCCAAATCCAGG | No data | ||||
1149072421_1149072423 | 10 | Left | 1149072421 | 17:52558390-52558412 | CCAGGAGGGGCAAGATACCAGGT | No data | ||
Right | 1149072423 | 17:52558423-52558445 | ATATTTGAGCCCCCAAATCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1149072423 | Original CRISPR | ATATTTGAGCCCCCAAATCC AGG | Intergenic | ||