ID: 1149072723

View in Genome Browser
Species Human (GRCh38)
Location 17:52562137-52562159
Sequence TATTGTGACAAGAGTGTTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149072714_1149072723 25 Left 1149072714 17:52562089-52562111 CCCAGAGGTAGATGGCTCAGAGG No data
Right 1149072723 17:52562137-52562159 TATTGTGACAAGAGTGTTGACGG No data
1149072716_1149072723 24 Left 1149072716 17:52562090-52562112 CCAGAGGTAGATGGCTCAGAGGC No data
Right 1149072723 17:52562137-52562159 TATTGTGACAAGAGTGTTGACGG No data
1149072718_1149072723 1 Left 1149072718 17:52562113-52562135 CCATTACCAGCACCCAAAGCCAT No data
Right 1149072723 17:52562137-52562159 TATTGTGACAAGAGTGTTGACGG No data
1149072719_1149072723 -5 Left 1149072719 17:52562119-52562141 CCAGCACCCAAAGCCATCTATTG No data
Right 1149072723 17:52562137-52562159 TATTGTGACAAGAGTGTTGACGG No data
1149072717_1149072723 2 Left 1149072717 17:52562112-52562134 CCCATTACCAGCACCCAAAGCCA No data
Right 1149072723 17:52562137-52562159 TATTGTGACAAGAGTGTTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149072723 Original CRISPR TATTGTGACAAGAGTGTTGA CGG Intergenic
No off target data available for this crispr