ID: 1149075093

View in Genome Browser
Species Human (GRCh38)
Location 17:52587356-52587378
Sequence ATGGGTACAAACATAGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149075093_1149075102 25 Left 1149075093 17:52587356-52587378 CCTAATTCTATGTTTGTACCCAT No data
Right 1149075102 17:52587404-52587426 TGAAAACACACACATGCAGCTGG No data
1149075093_1149075103 26 Left 1149075093 17:52587356-52587378 CCTAATTCTATGTTTGTACCCAT No data
Right 1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149075093 Original CRISPR ATGGGTACAAACATAGAATT AGG (reversed) Intergenic
No off target data available for this crispr