ID: 1149075095

View in Genome Browser
Species Human (GRCh38)
Location 17:52587375-52587397
Sequence GGGATGAAGAGGTTGGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149075095_1149075103 7 Left 1149075095 17:52587375-52587397 CCATTAACCAACCTCTTCATCCC No data
Right 1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG No data
1149075095_1149075104 15 Left 1149075095 17:52587375-52587397 CCATTAACCAACCTCTTCATCCC No data
Right 1149075104 17:52587413-52587435 ACACATGCAGCTGGGTGCAGTGG No data
1149075095_1149075102 6 Left 1149075095 17:52587375-52587397 CCATTAACCAACCTCTTCATCCC No data
Right 1149075102 17:52587404-52587426 TGAAAACACACACATGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149075095 Original CRISPR GGGATGAAGAGGTTGGTTAA TGG (reversed) Intergenic
No off target data available for this crispr