ID: 1149075097

View in Genome Browser
Species Human (GRCh38)
Location 17:52587386-52587408
Sequence TTTCAGGGTTAGGGATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149075097_1149075103 -4 Left 1149075097 17:52587386-52587408 CCTCTTCATCCCTAACCCTGAAA No data
Right 1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG No data
1149075097_1149075102 -5 Left 1149075097 17:52587386-52587408 CCTCTTCATCCCTAACCCTGAAA No data
Right 1149075102 17:52587404-52587426 TGAAAACACACACATGCAGCTGG No data
1149075097_1149075104 4 Left 1149075097 17:52587386-52587408 CCTCTTCATCCCTAACCCTGAAA No data
Right 1149075104 17:52587413-52587435 ACACATGCAGCTGGGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149075097 Original CRISPR TTTCAGGGTTAGGGATGAAG AGG (reversed) Intergenic
No off target data available for this crispr