ID: 1149075103

View in Genome Browser
Species Human (GRCh38)
Location 17:52587405-52587427
Sequence GAAAACACACACATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149075094_1149075103 8 Left 1149075094 17:52587374-52587396 CCCATTAACCAACCTCTTCATCC No data
Right 1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG No data
1149075097_1149075103 -4 Left 1149075097 17:52587386-52587408 CCTCTTCATCCCTAACCCTGAAA No data
Right 1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG No data
1149075095_1149075103 7 Left 1149075095 17:52587375-52587397 CCATTAACCAACCTCTTCATCCC No data
Right 1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG No data
1149075096_1149075103 0 Left 1149075096 17:52587382-52587404 CCAACCTCTTCATCCCTAACCCT No data
Right 1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG No data
1149075093_1149075103 26 Left 1149075093 17:52587356-52587378 CCTAATTCTATGTTTGTACCCAT No data
Right 1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149075103 Original CRISPR GAAAACACACACATGCAGCT GGG Intergenic
No off target data available for this crispr