ID: 1149075241

View in Genome Browser
Species Human (GRCh38)
Location 17:52589058-52589080
Sequence CTGTGTTAGTAGCCTGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149075238_1149075241 -8 Left 1149075238 17:52589043-52589065 CCCATTTATCCACTTCTGTGTTA No data
Right 1149075241 17:52589058-52589080 CTGTGTTAGTAGCCTGTTTGTGG No data
1149075239_1149075241 -9 Left 1149075239 17:52589044-52589066 CCATTTATCCACTTCTGTGTTAG No data
Right 1149075241 17:52589058-52589080 CTGTGTTAGTAGCCTGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149075241 Original CRISPR CTGTGTTAGTAGCCTGTTTG TGG Intergenic
No off target data available for this crispr