ID: 1149079382

View in Genome Browser
Species Human (GRCh38)
Location 17:52635426-52635448
Sequence GTGGATTACTAGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149079376_1149079382 19 Left 1149079376 17:52635384-52635406 CCTTGAGTACACATGGACATAGA No data
Right 1149079382 17:52635426-52635448 GTGGATTACTAGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149079382 Original CRISPR GTGGATTACTAGAGGGGAGA GGG Intergenic
No off target data available for this crispr