ID: 1149080261

View in Genome Browser
Species Human (GRCh38)
Location 17:52647877-52647899
Sequence GCCTAAGCCTGACCTAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149080261_1149080263 25 Left 1149080261 17:52647877-52647899 CCTACTCTAGGTCAGGCTTAGGC No data
Right 1149080263 17:52647925-52647947 TGCCAAGAGCTCCTAAGTGATGG No data
1149080261_1149080262 -7 Left 1149080261 17:52647877-52647899 CCTACTCTAGGTCAGGCTTAGGC No data
Right 1149080262 17:52647893-52647915 CTTAGGCAATATGTGAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149080261 Original CRISPR GCCTAAGCCTGACCTAGAGT AGG (reversed) Intergenic
No off target data available for this crispr