ID: 1149082246

View in Genome Browser
Species Human (GRCh38)
Location 17:52673038-52673060
Sequence ACGGGGAGATTGAGTGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149082246_1149082251 14 Left 1149082246 17:52673038-52673060 CCTGTAGCACTCAATCTCCCCGT No data
Right 1149082251 17:52673075-52673097 ATCTGGATTAAATGAAATTTTGG No data
1149082246_1149082252 19 Left 1149082246 17:52673038-52673060 CCTGTAGCACTCAATCTCCCCGT No data
Right 1149082252 17:52673080-52673102 GATTAAATGAAATTTTGGTGAGG No data
1149082246_1149082250 -3 Left 1149082246 17:52673038-52673060 CCTGTAGCACTCAATCTCCCCGT No data
Right 1149082250 17:52673058-52673080 CGTATTTCAGTTTCTATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149082246 Original CRISPR ACGGGGAGATTGAGTGCTAC AGG (reversed) Intergenic
No off target data available for this crispr