ID: 1149083592

View in Genome Browser
Species Human (GRCh38)
Location 17:52687138-52687160
Sequence TGGGTGCCTGCATTCAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149083592_1149083596 -4 Left 1149083592 17:52687138-52687160 CCTCAGCTGAATGCAGGCACCCA No data
Right 1149083596 17:52687157-52687179 CCCAGGGAGCTGTCATCTATAGG No data
1149083592_1149083598 13 Left 1149083592 17:52687138-52687160 CCTCAGCTGAATGCAGGCACCCA No data
Right 1149083598 17:52687174-52687196 TATAGGCCACCTGCTCAGTCAGG No data
1149083592_1149083601 27 Left 1149083592 17:52687138-52687160 CCTCAGCTGAATGCAGGCACCCA No data
Right 1149083601 17:52687188-52687210 TCAGTCAGGCTCTAACCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149083592 Original CRISPR TGGGTGCCTGCATTCAGCTG AGG (reversed) Intergenic
No off target data available for this crispr