ID: 1149085289

View in Genome Browser
Species Human (GRCh38)
Location 17:52709626-52709648
Sequence TCACGATGGCCACAGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149085283_1149085289 23 Left 1149085283 17:52709580-52709602 CCAGATCAAAGTTGTAGTGTCCA No data
Right 1149085289 17:52709626-52709648 TCACGATGGCCACAGCCCAGAGG No data
1149085286_1149085289 3 Left 1149085286 17:52709600-52709622 CCAATTGATGGCAGTGGCTGCTG No data
Right 1149085289 17:52709626-52709648 TCACGATGGCCACAGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149085289 Original CRISPR TCACGATGGCCACAGCCCAG AGG Intergenic
No off target data available for this crispr