ID: 1149085438

View in Genome Browser
Species Human (GRCh38)
Location 17:52710207-52710229
Sequence GCAGAATCCTGGGCTCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149085433_1149085438 -4 Left 1149085433 17:52710188-52710210 CCTTGAATGGCAGTTGGAAGCAG No data
Right 1149085438 17:52710207-52710229 GCAGAATCCTGGGCTCACAGGGG No data
1149085431_1149085438 2 Left 1149085431 17:52710182-52710204 CCAGGGCCTTGAATGGCAGTTGG No data
Right 1149085438 17:52710207-52710229 GCAGAATCCTGGGCTCACAGGGG No data
1149085429_1149085438 4 Left 1149085429 17:52710180-52710202 CCCCAGGGCCTTGAATGGCAGTT No data
Right 1149085438 17:52710207-52710229 GCAGAATCCTGGGCTCACAGGGG No data
1149085430_1149085438 3 Left 1149085430 17:52710181-52710203 CCCAGGGCCTTGAATGGCAGTTG No data
Right 1149085438 17:52710207-52710229 GCAGAATCCTGGGCTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149085438 Original CRISPR GCAGAATCCTGGGCTCACAG GGG Intergenic
No off target data available for this crispr