ID: 1149092073

View in Genome Browser
Species Human (GRCh38)
Location 17:52795502-52795524
Sequence AGGCCTGGGGCTGCCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149092073_1149092078 13 Left 1149092073 17:52795502-52795524 CCTGAAAAGGCAGCCCCAGGCCT No data
Right 1149092078 17:52795538-52795560 ATTGTCTCCTTGCATTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149092073 Original CRISPR AGGCCTGGGGCTGCCTTTTC AGG (reversed) Intergenic
No off target data available for this crispr