ID: 1149110514

View in Genome Browser
Species Human (GRCh38)
Location 17:53022841-53022863
Sequence GCCTCAAGGGTGTTTCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149110509_1149110514 -6 Left 1149110509 17:53022824-53022846 CCACCCAATTCACTGGTGCCTCA No data
Right 1149110514 17:53022841-53022863 GCCTCAAGGGTGTTTCTCCCAGG No data
1149110506_1149110514 13 Left 1149110506 17:53022805-53022827 CCTGATGTCAGACATCAGCCCAC No data
Right 1149110514 17:53022841-53022863 GCCTCAAGGGTGTTTCTCCCAGG No data
1149110510_1149110514 -9 Left 1149110510 17:53022827-53022849 CCCAATTCACTGGTGCCTCAAGG No data
Right 1149110514 17:53022841-53022863 GCCTCAAGGGTGTTTCTCCCAGG No data
1149110505_1149110514 14 Left 1149110505 17:53022804-53022826 CCCTGATGTCAGACATCAGCCCA No data
Right 1149110514 17:53022841-53022863 GCCTCAAGGGTGTTTCTCCCAGG No data
1149110508_1149110514 -5 Left 1149110508 17:53022823-53022845 CCCACCCAATTCACTGGTGCCTC No data
Right 1149110514 17:53022841-53022863 GCCTCAAGGGTGTTTCTCCCAGG No data
1149110512_1149110514 -10 Left 1149110512 17:53022828-53022850 CCAATTCACTGGTGCCTCAAGGG No data
Right 1149110514 17:53022841-53022863 GCCTCAAGGGTGTTTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149110514 Original CRISPR GCCTCAAGGGTGTTTCTCCC AGG Intergenic
No off target data available for this crispr