ID: 1149114164

View in Genome Browser
Species Human (GRCh38)
Location 17:53071726-53071748
Sequence AAGGAGAAGAAGAAAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149114159_1149114164 3 Left 1149114159 17:53071700-53071722 CCAGTTCTAAGGAAGGAAGAAGG No data
Right 1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149114164 Original CRISPR AAGGAGAAGAAGAAAAAGGA GGG Intergenic
No off target data available for this crispr