ID: 1149115223

View in Genome Browser
Species Human (GRCh38)
Location 17:53085988-53086010
Sequence CATTACTCACAAGTGTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149115223_1149115230 29 Left 1149115223 17:53085988-53086010 CCAACCTACACTTGTGAGTAATG No data
Right 1149115230 17:53086040-53086062 TGTTTTAATTTTCAGCAAGAAGG No data
1149115223_1149115228 0 Left 1149115223 17:53085988-53086010 CCAACCTACACTTGTGAGTAATG No data
Right 1149115228 17:53086011-53086033 CAGGGGAAGTAGAGTTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149115223 Original CRISPR CATTACTCACAAGTGTAGGT TGG (reversed) Intergenic
No off target data available for this crispr