ID: 1149118926

View in Genome Browser
Species Human (GRCh38)
Location 17:53137345-53137367
Sequence CCTCACCTGTACAAACTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149118926_1149118935 26 Left 1149118926 17:53137345-53137367 CCCCCCAGTTTGTACAGGTGAGG No data
Right 1149118935 17:53137394-53137416 CTAATAACTTAGATAGAAAAGGG No data
1149118926_1149118934 25 Left 1149118926 17:53137345-53137367 CCCCCCAGTTTGTACAGGTGAGG No data
Right 1149118934 17:53137393-53137415 TCTAATAACTTAGATAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149118926 Original CRISPR CCTCACCTGTACAAACTGGG GGG (reversed) Intergenic
No off target data available for this crispr