ID: 1149122151

View in Genome Browser
Species Human (GRCh38)
Location 17:53182461-53182483
Sequence GAGGTGTGACCTTAGATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149122147_1149122151 30 Left 1149122147 17:53182408-53182430 CCTTTCTGCTGCTGGGTTTGGGT No data
Right 1149122151 17:53182461-53182483 GAGGTGTGACCTTAGATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149122151 Original CRISPR GAGGTGTGACCTTAGATTAT AGG Intergenic
No off target data available for this crispr