ID: 1149124428

View in Genome Browser
Species Human (GRCh38)
Location 17:53210540-53210562
Sequence TCACATGACAAGAGGGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149124428_1149124434 8 Left 1149124428 17:53210540-53210562 CCTTTTGCCCTCTTGTCATGTGA No data
Right 1149124434 17:53210571-53210593 TGAGAAGGCACCATCTTTGAAGG No data
1149124428_1149124436 19 Left 1149124428 17:53210540-53210562 CCTTTTGCCCTCTTGTCATGTGA No data
Right 1149124436 17:53210582-53210604 CATCTTTGAAGGATAGAGTGAGG No data
1149124428_1149124437 29 Left 1149124428 17:53210540-53210562 CCTTTTGCCCTCTTGTCATGTGA No data
Right 1149124437 17:53210592-53210614 GGATAGAGTGAGGCCTCACCAGG No data
1149124428_1149124432 -7 Left 1149124428 17:53210540-53210562 CCTTTTGCCCTCTTGTCATGTGA No data
Right 1149124432 17:53210556-53210578 CATGTGAGGACACCGTGAGAAGG 0: 3
1: 216
2: 680
3: 1551
4: 2462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149124428 Original CRISPR TCACATGACAAGAGGGCAAA AGG (reversed) Intergenic
No off target data available for this crispr