ID: 1149126430

View in Genome Browser
Species Human (GRCh38)
Location 17:53239674-53239696
Sequence CATTTTGAAGTATTGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149126425_1149126430 10 Left 1149126425 17:53239641-53239663 CCTATGTAATGACCAGATCTCCA No data
Right 1149126430 17:53239674-53239696 CATTTTGAAGTATTGGAGGTTGG No data
1149126427_1149126430 -10 Left 1149126427 17:53239661-53239683 CCAAATATAGTCACATTTTGAAG No data
Right 1149126430 17:53239674-53239696 CATTTTGAAGTATTGGAGGTTGG No data
1149126426_1149126430 -2 Left 1149126426 17:53239653-53239675 CCAGATCTCCAAATATAGTCACA No data
Right 1149126430 17:53239674-53239696 CATTTTGAAGTATTGGAGGTTGG No data
1149126423_1149126430 28 Left 1149126423 17:53239623-53239645 CCCATGTAAACACAAACACCTAT No data
Right 1149126430 17:53239674-53239696 CATTTTGAAGTATTGGAGGTTGG No data
1149126424_1149126430 27 Left 1149126424 17:53239624-53239646 CCATGTAAACACAAACACCTATG No data
Right 1149126430 17:53239674-53239696 CATTTTGAAGTATTGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149126430 Original CRISPR CATTTTGAAGTATTGGAGGT TGG Intergenic
No off target data available for this crispr