ID: 1149126496

View in Genome Browser
Species Human (GRCh38)
Location 17:53240955-53240977
Sequence CAGGCGTGAGCCACCTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 435074
Summary {0: 356, 1: 19722, 2: 89501, 3: 146736, 4: 178759}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149126496_1149126502 21 Left 1149126496 17:53240955-53240977 CCAGGCAAGGTGGCTCACGCCTG 0: 356
1: 19722
2: 89501
3: 146736
4: 178759
Right 1149126502 17:53240999-53241021 TTTGACCTGAGGTCAGGAGTTGG No data
1149126496_1149126497 -6 Left 1149126496 17:53240955-53240977 CCAGGCAAGGTGGCTCACGCCTG 0: 356
1: 19722
2: 89501
3: 146736
4: 178759
Right 1149126497 17:53240972-53240994 CGCCTGTAATTCTAGCACTCAGG 0: 8
1: 642
2: 17121
3: 168275
4: 297075
1149126496_1149126501 15 Left 1149126496 17:53240955-53240977 CCAGGCAAGGTGGCTCACGCCTG 0: 356
1: 19722
2: 89501
3: 146736
4: 178759
Right 1149126501 17:53240993-53241015 GGTGGCTTTGACCTGAGGTCAGG No data
1149126496_1149126499 -3 Left 1149126496 17:53240955-53240977 CCAGGCAAGGTGGCTCACGCCTG 0: 356
1: 19722
2: 89501
3: 146736
4: 178759
Right 1149126499 17:53240975-53240997 CTGTAATTCTAGCACTCAGGTGG No data
1149126496_1149126500 10 Left 1149126496 17:53240955-53240977 CCAGGCAAGGTGGCTCACGCCTG 0: 356
1: 19722
2: 89501
3: 146736
4: 178759
Right 1149126500 17:53240988-53241010 ACTCAGGTGGCTTTGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149126496 Original CRISPR CAGGCGTGAGCCACCTTGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr