ID: 1149126497

View in Genome Browser
Species Human (GRCh38)
Location 17:53240972-53240994
Sequence CGCCTGTAATTCTAGCACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 483121
Summary {0: 8, 1: 642, 2: 17121, 3: 168275, 4: 297075}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149126496_1149126497 -6 Left 1149126496 17:53240955-53240977 CCAGGCAAGGTGGCTCACGCCTG 0: 356
1: 19722
2: 89501
3: 146736
4: 178759
Right 1149126497 17:53240972-53240994 CGCCTGTAATTCTAGCACTCAGG 0: 8
1: 642
2: 17121
3: 168275
4: 297075
1149126491_1149126497 29 Left 1149126491 17:53240920-53240942 CCTAAAATATGTAAAACATATAG No data
Right 1149126497 17:53240972-53240994 CGCCTGTAATTCTAGCACTCAGG 0: 8
1: 642
2: 17121
3: 168275
4: 297075
1149126490_1149126497 30 Left 1149126490 17:53240919-53240941 CCCTAAAATATGTAAAACATATA No data
Right 1149126497 17:53240972-53240994 CGCCTGTAATTCTAGCACTCAGG 0: 8
1: 642
2: 17121
3: 168275
4: 297075

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149126497 Original CRISPR CGCCTGTAATTCTAGCACTC AGG Intergenic
Too many off-targets to display for this crispr