ID: 1149126499

View in Genome Browser
Species Human (GRCh38)
Location 17:53240975-53240997
Sequence CTGTAATTCTAGCACTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149126496_1149126499 -3 Left 1149126496 17:53240955-53240977 CCAGGCAAGGTGGCTCACGCCTG 0: 356
1: 19722
2: 89501
3: 146736
4: 178759
Right 1149126499 17:53240975-53240997 CTGTAATTCTAGCACTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149126499 Original CRISPR CTGTAATTCTAGCACTCAGG TGG Intergenic
No off target data available for this crispr