ID: 1149126499 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:53240975-53240997 |
| Sequence | CTGTAATTCTAGCACTCAGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1149126496_1149126499 | -3 | Left | 1149126496 | 17:53240955-53240977 | CCAGGCAAGGTGGCTCACGCCTG | 0: 356 1: 19722 2: 89501 3: 146736 4: 178759 |
||
| Right | 1149126499 | 17:53240975-53240997 | CTGTAATTCTAGCACTCAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1149126499 | Original CRISPR | CTGTAATTCTAGCACTCAGG TGG | Intergenic | ||
| No off target data available for this crispr | |||||