ID: 1149126500

View in Genome Browser
Species Human (GRCh38)
Location 17:53240988-53241010
Sequence ACTCAGGTGGCTTTGACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149126498_1149126500 -9 Left 1149126498 17:53240974-53240996 CCTGTAATTCTAGCACTCAGGTG No data
Right 1149126500 17:53240988-53241010 ACTCAGGTGGCTTTGACCTGAGG No data
1149126496_1149126500 10 Left 1149126496 17:53240955-53240977 CCAGGCAAGGTGGCTCACGCCTG 0: 356
1: 19722
2: 89501
3: 146736
4: 178759
Right 1149126500 17:53240988-53241010 ACTCAGGTGGCTTTGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149126500 Original CRISPR ACTCAGGTGGCTTTGACCTG AGG Intergenic
No off target data available for this crispr