ID: 1149141242

View in Genome Browser
Species Human (GRCh38)
Location 17:53435747-53435769
Sequence CTGTGGTTGTTGAGATGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 242}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149141235_1149141242 1 Left 1149141235 17:53435723-53435745 CCCTGCACCTTGTCCAGATGCCA 0: 1
1: 1
2: 1
3: 15
4: 174
Right 1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG 0: 1
1: 0
2: 0
3: 37
4: 242
1149141237_1149141242 -6 Left 1149141237 17:53435730-53435752 CCTTGTCCAGATGCCACCTGTGG 0: 1
1: 0
2: 2
3: 19
4: 182
Right 1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG 0: 1
1: 0
2: 0
3: 37
4: 242
1149141233_1149141242 19 Left 1149141233 17:53435705-53435727 CCTTGAAAGACAAGAGTCCCCTG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG 0: 1
1: 0
2: 0
3: 37
4: 242
1149141236_1149141242 0 Left 1149141236 17:53435724-53435746 CCTGCACCTTGTCCAGATGCCAC 0: 1
1: 1
2: 0
3: 21
4: 168
Right 1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG 0: 1
1: 0
2: 0
3: 37
4: 242
1149141234_1149141242 2 Left 1149141234 17:53435722-53435744 CCCCTGCACCTTGTCCAGATGCC 0: 1
1: 1
2: 3
3: 34
4: 347
Right 1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG 0: 1
1: 0
2: 0
3: 37
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149141242 Original CRISPR CTGTGGTTGTTGAGATGAGA TGG Intergenic
900805823 1:4767758-4767780 CTGTGCTTCTTGTGATGAGAAGG - Intronic
901370608 1:8794456-8794478 CTGTGATTGTTGAGGTGGCAGGG + Intronic
902040730 1:13490526-13490548 CAGTGATGGTTGAGATGACAGGG - Intronic
902376031 1:16030290-16030312 CTGGGCTTGGTGAGAGGAGAGGG - Intronic
902380970 1:16052035-16052057 CTGGGCTTGGTGAGAGGAGAGGG - Intronic
903640832 1:24859148-24859170 CTGAGGTTGAGGAGATGAGGGGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
905086115 1:35379103-35379125 CTGTTGTTGTTGTTTTGAGACGG + Intronic
906795002 1:48689684-48689706 CTGTGTGTGTTGGGATGAGATGG + Intronic
907327800 1:53652266-53652288 CTGAGGATGTGGAGATGAGTTGG + Intronic
909893956 1:81042473-81042495 CTGTGGTTATAAAGATGAAAAGG + Intergenic
911078485 1:93904385-93904407 CTGTGGTTGATTTGCTGAGACGG - Intronic
915398250 1:155602470-155602492 CTGTTGTTGTTGTTTTGAGATGG - Intergenic
915486144 1:156222126-156222148 TTGGGGTTGGTGAGATGGGAAGG - Intronic
919893794 1:201995572-201995594 CTGGGGTTGGGGAGCTGAGATGG + Intronic
920845754 1:209591882-209591904 CTGGGGTTGGTGAGAAGAGACGG - Intronic
923159558 1:231304782-231304804 GTATGGTTGTTGAGACTAGATGG - Intergenic
924543632 1:245005018-245005040 CTGTGTCTATTGAGATGACATGG + Intronic
924619783 1:245650468-245650490 CTGTGGTCCTTCAGATGAGCTGG - Intronic
1064579204 10:16776860-16776882 CTATGATTGTAAAGATGAGATGG + Intronic
1064579302 10:16777965-16777987 CTATGATTGTAAAGATGAGATGG + Intronic
1064709614 10:18110030-18110052 TTGTAGTTATTCAGATGAGAGGG + Intergenic
1065121400 10:22533900-22533922 CTGTGGTTGTGGGCATCAGAAGG + Intergenic
1065393432 10:25208501-25208523 CCGTGGTTCTGGTGATGAGATGG - Intronic
1066049594 10:31621450-31621472 CTGTGGGAGTTGTGATGTGACGG + Intergenic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1067826067 10:49573958-49573980 CTGTGGCTGGTCAGATGAGGGGG + Intergenic
1069765008 10:70849677-70849699 CCGTGGTTGTTGAGTGAAGAGGG + Intronic
1071044391 10:81355971-81355993 CTGTGGTGGCTGAGTTGAGAGGG - Intergenic
1072163158 10:92787030-92787052 CTGTGTTTGCTGAGATGGGTAGG - Intergenic
1074582702 10:114735473-114735495 CTGTTGTTGTTGTTTTGAGACGG + Intergenic
1074584454 10:114753854-114753876 TTTTGTTTTTTGAGATGAGATGG + Intergenic
1075579189 10:123603961-123603983 CCGTGGAGGTTGGGATGAGAAGG - Intergenic
1075657737 10:124173310-124173332 CTGTGGTTGGCGGGATGGGATGG - Intergenic
1076075890 10:127533605-127533627 CTCTGGCTGCTGAGATGAGGTGG + Intergenic
1076493702 10:130882487-130882509 CTGTGGTTGTGAGGATGAGCTGG - Intergenic
1077093088 11:788350-788372 CTGTGGTTGTTGAGAAGGGCAGG + Exonic
1079389551 11:20009720-20009742 GTGTGGTTGAAGAGAGGAGAAGG - Intronic
1080938862 11:36891835-36891857 CTATAGTTGTTGAGAAGAGAAGG + Intergenic
1081122283 11:39282401-39282423 CTGTGCCTTTTTAGATGAGATGG - Intergenic
1082820972 11:57544373-57544395 CTGTTGTTGTTGTTTTGAGAGGG - Intronic
1085258531 11:75191012-75191034 CTGTGGATGCTGAGGAGAGATGG + Intronic
1085835146 11:79947826-79947848 CTGTTTTTAATGAGATGAGAAGG - Intergenic
1086023456 11:82260909-82260931 CTGTTGTTGTTGTTAGGAGATGG + Intergenic
1089006258 11:115093872-115093894 CTCTCATTGTTGATATGAGATGG - Intergenic
1090593245 11:128294062-128294084 CTGTGGTCCTTGCGGTGAGAGGG - Intergenic
1091612680 12:2024587-2024609 TTCTGGTTGTTGGGCTGAGAGGG - Intronic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1092468918 12:8761235-8761257 CTCAGGTGGTTGAGACGAGAGGG + Intronic
1092598851 12:10036569-10036591 CTGTGGATGTGTAGAAGAGAAGG - Intronic
1092657069 12:10697296-10697318 CTGTGGTTGTTCATATTTGATGG - Intergenic
1093252386 12:16822453-16822475 ATGTGGTTGTTGAGATGATTAGG + Intergenic
1094276612 12:28684402-28684424 CGGTGGTTGTTGGGATGGAATGG - Intergenic
1096843687 12:54393633-54393655 CTGTGTTGGTGGAGATGAAAAGG - Intergenic
1097747682 12:63317680-63317702 CTTTGGGTGTTGGGATGAGGTGG + Intergenic
1098652754 12:72993564-72993586 CTTGGTTTGATGAGATGAGAAGG - Intergenic
1102397233 12:112597178-112597200 CTGTGATTGTTGAGAAAAGACGG + Intronic
1103014607 12:117484291-117484313 CTGAGGTTGCTGAGCTGAGTGGG - Intronic
1103413760 12:120730694-120730716 CTGTGTTTCTGGGGATGAGATGG + Intronic
1105510204 13:21045386-21045408 CTGTTCTTGTGGAGATGAAAAGG - Intronic
1105569562 13:21588734-21588756 CTCTGGTTGATGAGATGCTAGGG - Intronic
1105849722 13:24323209-24323231 CTGTGGTTGTTGAGAAGGGCGGG - Intergenic
1107701601 13:43054144-43054166 CTGTGCCTGTTGAGATGATCGGG + Intronic
1109289745 13:60459623-60459645 CTTTTGTTGTTGTGTTGAGACGG + Intronic
1110886041 13:80636820-80636842 CTCTGCTTGTGGAAATGAGAGGG - Intergenic
1111378095 13:87407574-87407596 CTAAGGGTTTTGAGATGAGAAGG - Intergenic
1111830853 13:93327331-93327353 CTGTGACTGTTGAGATGATGTGG + Intronic
1112290502 13:98141907-98141929 CTGTGGTTGAAGAGAAGAAATGG - Intergenic
1113110679 13:106819895-106819917 CTGGTGTTGTTAAGATGAAACGG + Intergenic
1113194956 13:107791954-107791976 CTGTTGTTGTTGTTTTGAGATGG - Intronic
1113579355 13:111418222-111418244 GTGTGGAAGCTGAGATGAGAGGG - Intergenic
1115659395 14:35477120-35477142 CTGGGGTTGTAGAGAGGAAAGGG - Intergenic
1115952166 14:38733544-38733566 CTGTGGTTCTTCCCATGAGAAGG + Intergenic
1116057820 14:39885627-39885649 CTGTGCTTGAGGAGAAGAGAGGG + Intergenic
1118452582 14:65917600-65917622 CTGTGGTTCCTGAGAAAAGAGGG - Intergenic
1121781134 14:96623353-96623375 CTGAGCATGTTGAGAGGAGATGG + Intergenic
1121782246 14:96629441-96629463 TGGTGGTTGTTGTCATGAGAGGG + Intergenic
1122255736 14:100474356-100474378 CTGTGTTTGTGGAGATGTGAAGG - Intronic
1122903107 14:104790075-104790097 ATGTGGTCATTGAGATGAGAGGG - Intronic
1124186210 15:27531595-27531617 CTGTGCTGGTTGATCTGAGATGG - Intronic
1125037780 15:35146484-35146506 CTTTGGATGTTATGATGAGAGGG + Intergenic
1126086124 15:45012627-45012649 CTGTTGTTGTTGTTTTGAGATGG + Intergenic
1126322327 15:47438341-47438363 CTGTGGCTGCTGTGTTGAGATGG - Intronic
1128267812 15:66281960-66281982 TTGACGATGTTGAGATGAGAAGG + Intergenic
1129230733 15:74195964-74195986 CTGGGGTTGGTGTGATGGGATGG - Intronic
1129566105 15:76625135-76625157 CTGGGGGTGTGGAGATGAGCTGG + Intronic
1132473153 16:118071-118093 CTGTGGAGGCTGTGATGAGAAGG + Intronic
1132617730 16:850535-850557 CTGTGGTTGTTGTTGTCAGAAGG + Intergenic
1132663665 16:1072392-1072414 CTGGGGTTGTGGAGATAAGTGGG - Intergenic
1133338127 16:5019825-5019847 CTGTTGTTGTTGTTTTGAGACGG - Intergenic
1135702437 16:24643920-24643942 TAGTGGATGATGAGATGAGAGGG + Intergenic
1136001878 16:27300817-27300839 CTATGGTGGTAGAAATGAGATGG - Intergenic
1136289921 16:29265331-29265353 CTGTCCTTGTTGAGAAGAGCAGG + Intergenic
1136472334 16:30489415-30489437 TTCTGGTTGTTGAGGTCAGATGG + Intronic
1137580212 16:49628990-49629012 CTTTGGTTCCTGGGATGAGAGGG + Intronic
1138226377 16:55299019-55299041 GTATGGTTGTTGCAATGAGATGG + Intergenic
1139008292 16:62600857-62600879 GTGTGGATGCTGAGATGAGCTGG + Intergenic
1140330232 16:74049396-74049418 TAGTGGTTGTTGAGATGTGGTGG - Intergenic
1140485304 16:75288743-75288765 ATGTGGTTGGTGTGGTGAGATGG - Intergenic
1141051521 16:80769085-80769107 CTGTGGTTGATGATATGTGATGG - Intronic
1142095806 16:88238807-88238829 CTGTCCTTGTTGAGAAGAGCAGG + Intergenic
1144462387 17:15468517-15468539 CTGTGGTTGCAGAGAAGTGAGGG - Intronic
1147243432 17:39105615-39105637 CTCTGGTTGTTAAGGTGAAAGGG - Intronic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1152288980 17:79428216-79428238 CTGTGACTGTGGAGATGGGAGGG - Intronic
1152588302 17:81198901-81198923 CTGTGGTTCTGGGGATGAGTCGG + Exonic
1153205134 18:2691140-2691162 CTGTGGTGGTTAAGACAAGATGG - Intronic
1153640899 18:7156179-7156201 GAGTGGGTGTTGAGAGGAGATGG - Intergenic
1153940214 18:9970338-9970360 CTCTGGTGGCTGAGCTGAGAGGG - Intergenic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1155772550 18:29720331-29720353 CTCTGGTTTTGTAGATGAGAGGG - Intergenic
1158525120 18:58206382-58206404 CTGTTGTTGTTGTTTTGAGATGG - Intronic
1159539978 18:69762232-69762254 CTCTGGAGGTTGAGATGGGAGGG + Intronic
1160091142 18:75827737-75827759 CCGTGGCTGATGAGATGAGCAGG - Intergenic
1160378336 18:78430295-78430317 CTGTGGTATTTGTGATGAGCTGG - Intergenic
1163375051 19:16924996-16925018 CTGTGGCTGTTAGGATGAGATGG - Intronic
1166335756 19:42106104-42106126 CTTTCTTTTTTGAGATGAGATGG + Intronic
924997034 2:371240-371262 CTGTATTTATTGAGACGAGAGGG + Intergenic
925522793 2:4766360-4766382 CTGTGGTTCTAGAATTGAGATGG + Intergenic
925955544 2:8960554-8960576 CTATGGTTGTGGAGATCAGCGGG - Intronic
926619532 2:15034629-15034651 CTCTGATTATTGAGATGAGCAGG - Intergenic
928238603 2:29567161-29567183 CTTTGGTTGTTGAGAACAGCTGG - Intronic
928435569 2:31252478-31252500 CTGTTGTTGTTGTTTTGAGACGG + Intronic
928956275 2:36872348-36872370 CTGTGGTTGTTGAGAGGCCTTGG - Intronic
929301759 2:40311874-40311896 CTGAGTTTGTGGAGATGATAAGG - Intronic
930239126 2:48917720-48917742 TTGTTGTTGTTGAGACTAGATGG + Intergenic
930827988 2:55713679-55713701 TTGTGGTTGTTGTTTTGAGACGG + Intergenic
931134415 2:59380648-59380670 CTGTGTCTGTTGAAATGATAAGG - Intergenic
931570466 2:63663926-63663948 CGGTGGTTGTTGATATATGAGGG - Intronic
931987104 2:67752769-67752791 CTGTGGGAGCTGAGATGAGCTGG - Intergenic
933389333 2:81651155-81651177 CTGTGGTTGATGAAATGCCACGG + Intergenic
933658774 2:84909605-84909627 GTGTGGTGGTTGAGGTGTGATGG - Intergenic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
936898368 2:117455076-117455098 CTGTGGTTGCTGTGATGGGTTGG - Intergenic
937562342 2:123241362-123241384 TTCTGGTTGTTGAGATTTGAAGG + Intergenic
937781485 2:125843583-125843605 CTGTTGTTGTTAAGATGGGAGGG + Intergenic
937791481 2:125967315-125967337 CTCTGGTTAATGAGAGGAGATGG - Intergenic
937998942 2:127716654-127716676 CTCAGGTTGTTGATATGAAAAGG - Intronic
940514362 2:154661971-154661993 CGTTAGTAGTTGAGATGAGAAGG - Intergenic
944589973 2:201207890-201207912 CTGTTGTTGTTGTTTTGAGATGG - Intronic
945720378 2:213411166-213411188 CTCTGGTTGTTGAAATGCCAGGG - Intronic
948379443 2:237542363-237542385 CTGTGGTTGTTGAGAAGGGGGGG - Intronic
1169585196 20:7074170-7074192 CTTTGGTTGTTGAGTTGTAAAGG + Intergenic
1169961877 20:11169146-11169168 CTGTGAATGTTGAGAAGATATGG + Intergenic
1171996006 20:31731928-31731950 CTCTGGATGCTGAGATGAGAGGG - Intergenic
1172594764 20:36143105-36143127 CTGTGGTTGTGGCTATGTGAGGG + Intronic
1173383229 20:42565152-42565174 CTGTGTCTTTTGAGATGTGAAGG - Intronic
1174859640 20:54078633-54078655 CTGTGGTTCTAGAGCTGAGGTGG - Intergenic
1175321944 20:58094445-58094467 CTGGGGATGTGGAGATGAGTGGG + Intergenic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1177836379 21:26190070-26190092 TTGAGGTTGTTAAGATGAGCAGG + Intergenic
1178689364 21:34738554-34738576 ATGTGGTTCCTGGGATGAGAAGG - Intergenic
1179401101 21:41084703-41084725 CCCTGGTTGATGAGATGAAAAGG - Intergenic
1180668001 22:17530228-17530250 CTGTTGTTGTTGTTTTGAGACGG + Intronic
1180962352 22:19767591-19767613 CTGGGGAGGTTGGGATGAGACGG - Intronic
1181554071 22:23657536-23657558 TTGTTTTTTTTGAGATGAGATGG + Intergenic
1182917395 22:34047714-34047736 CAGTGGTGATTGAGATGAGACGG - Intergenic
1183591927 22:38784223-38784245 CCGGGGTTGTTGCGATGACAAGG - Intronic
1183777161 22:39973791-39973813 CTGTGGCTGGTGAGAGGAGCTGG - Intergenic
1184085485 22:42260498-42260520 GTATGGTTCTTGAGATGAGAGGG + Intronic
949914866 3:8952174-8952196 TTGGGGCTGTTGAGATGGGATGG - Intronic
950508010 3:13407670-13407692 CTGTGTTTGGTGAGCTAAGAAGG - Intronic
953118184 3:40013435-40013457 CTGTGCTGGTTCAGAAGAGAAGG + Intronic
954476196 3:50748307-50748329 CTGTGGTTTCTGAGTTTAGAGGG + Intronic
954814720 3:53271461-53271483 CTGAGGTTGTTGATCTGGGAAGG + Intergenic
956419342 3:69070030-69070052 CTGAGGTTGCTGAGATTAAATGG + Intronic
958056212 3:88415728-88415750 CTGTGGTTCTTGAAGTTAGATGG - Intergenic
958594196 3:96201071-96201093 CTGTGCTTGTTGAGGTGTAATGG - Intergenic
959065752 3:101655289-101655311 CTATGGTTGTTGACAGGAAATGG - Intronic
960037432 3:113115999-113116021 CAGGGGTTGTGGAGATGAAATGG - Intergenic
960466089 3:117997726-117997748 CTGTGTTTGCTGAGAGCAGAGGG - Intergenic
960847750 3:122020641-122020663 CTGTGGAGTTTGAGATGAGCAGG + Intronic
961412304 3:126731238-126731260 CTGTGGTTGTCCAGATGAACTGG + Intronic
961911104 3:130317533-130317555 CTGTGGTGGCTGATATGAAAAGG - Intergenic
963565777 3:146928484-146928506 CTGTGGTTCTTGAGCAGAGCAGG + Intergenic
964396761 3:156253945-156253967 TTCTGGTTGATGAGATGTGAGGG + Intronic
964472525 3:157070181-157070203 CTGGGGATGTTGAGAGGAAAAGG - Intergenic
965829698 3:172771541-172771563 CAGTGACAGTTGAGATGAGATGG + Intronic
966744507 3:183262938-183262960 CTGGGGTTGTTGGGGTGGGAGGG + Intronic
971571247 4:28213651-28213673 TTGTGGTTGTTTTGCTGAGAAGG + Intergenic
971801740 4:31301735-31301757 CTAAGGATGTTGAGATGGGAAGG + Intergenic
971829102 4:31666822-31666844 TGGTGGTTGTTGACATGGGAAGG + Intergenic
972789301 4:42355528-42355550 CTGTGGTTGCTGACATTAGATGG + Intergenic
974042923 4:56873269-56873291 CTTTTTTTGTAGAGATGAGAAGG + Intergenic
974403634 4:61437457-61437479 CTGTGAATGATGAGATGAGTGGG - Intronic
975880001 4:78893805-78893827 CTCTGGAGGTTGAGGTGAGAGGG - Intronic
976722107 4:88178806-88178828 CTCTGCTTGTGGAAATGAGAGGG + Intronic
977799422 4:101208350-101208372 CTGTGGTTGTTGAGAACAATGGG - Intronic
978268225 4:106853707-106853729 CTTTTGTTGTTGATCTGAGAAGG + Intergenic
979162963 4:117487171-117487193 CTGTTGTTGTTGTTTTGAGATGG + Intergenic
980251336 4:130319648-130319670 CTGTGGTTATGAAGAAGAGAGGG + Intergenic
980415427 4:132482755-132482777 CTGTGGTTGGAGAGAGCAGATGG + Intergenic
981926783 4:150148923-150148945 CTGGGGAGGCTGAGATGAGATGG + Intronic
983155325 4:164340187-164340209 CTTTGGTTGTTTAGAAGAGCTGG - Intronic
984545755 4:181100111-181100133 CTGAGTTTGTTGAGTTGAGGGGG + Intergenic
985048196 4:185962766-185962788 GTGTGGTAGCTGAGTTGAGAAGG - Intergenic
985732270 5:1556060-1556082 CTGGGGTTGGAGAGATGATAAGG - Intergenic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
993680059 5:90866008-90866030 CTGTGGTTCTTTAGCTAAGAGGG + Intronic
997668019 5:135647931-135647953 CTGTGGTTGTAGAGAGAGGAAGG + Intergenic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
999499226 5:152130171-152130193 CTGTGGTTATTGTGGTGGGAGGG - Intergenic
999737528 5:154523800-154523822 CTGTTATTGTCCAGATGAGAGGG - Intergenic
1000015925 5:157276367-157276389 CTGTGTGTATTGAGATGATATGG + Intronic
1001115444 5:168935432-168935454 CTCTGGTTGTAGAGATAAGATGG - Intronic
1002436445 5:179234673-179234695 CCTTGGATGTGGAGATGAGATGG - Intronic
1003343341 6:5242713-5242735 CTGTTGTTGTTGTTTTGAGAAGG - Intronic
1003566458 6:7226827-7226849 CTTGGGTTGTTGGGTTGAGAAGG + Intronic
1004741057 6:18461601-18461623 CTCTGGTTCTGGAGATGAAATGG + Intronic
1004905074 6:20229971-20229993 CTCTGGTTGGTGAGAGGATAGGG - Intergenic
1005081008 6:21956561-21956583 CTGTTGTTGTTGTTTTGAGATGG - Intergenic
1005952874 6:30644370-30644392 GTGAGATTGTCGAGATGAGATGG + Intronic
1007717430 6:43865315-43865337 CTGTGGGTGCGGAGATGGGAAGG + Intergenic
1007992524 6:46271532-46271554 CTGTGGTTGGGTAGCTGAGATGG - Intronic
1011262463 6:85483672-85483694 CTGTGGTTATTGAGCTGAAAGGG + Intronic
1012140674 6:95623293-95623315 ATGTGGTTGTTGGGATGATGTGG - Intergenic
1012640218 6:101601176-101601198 CTGTGTCTGTTGAGATTACATGG + Intronic
1013058073 6:106604600-106604622 CTGTGTTTGGTGAGATTATAGGG - Intronic
1013266873 6:108508478-108508500 ATCTGGTTGGTGAGAAGAGATGG + Intronic
1014169671 6:118265047-118265069 CTGAGGTTGCTGAGATGATAAGG - Intronic
1017280350 6:152617183-152617205 GTGTGGTTGTTTAGATGGGAAGG - Intronic
1018276326 6:162135670-162135692 CTGTGGATCTGCAGATGAGAGGG + Intronic
1019991872 7:4697465-4697487 CTGTGGCTGCTGAGCTGAGCCGG + Intronic
1021954041 7:25806019-25806041 CTGTAGTTGTTTAGCAGAGACGG - Intergenic
1022381254 7:29862064-29862086 GTGTGGTTGCTGACATGGGAGGG + Intronic
1022640229 7:32175120-32175142 CTGTGGTTGAAGAGATGACTAGG + Intronic
1022809146 7:33851921-33851943 CTGTGGTTAGTGAGATGGTAGGG + Intergenic
1023108527 7:36786979-36787001 TTGTTGTTGTTGAGAGGAGACGG - Intergenic
1023280076 7:38560305-38560327 CTGGGGCGGTTGGGATGAGATGG - Intronic
1024754406 7:52512733-52512755 CTGTGGGTGATGTGATGAGAGGG - Intergenic
1025790675 7:64684392-64684414 CTGAGGTTGTAGAGATCAGGGGG - Intronic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1028930592 7:96408881-96408903 TTGTGGTTGTTGGCAGGAGATGG + Intergenic
1031466249 7:122115775-122115797 CTGTGATTGGGGAAATGAGAAGG + Intronic
1032458145 7:132088799-132088821 CGGGGGATATTGAGATGAGAAGG - Intergenic
1032806740 7:135362810-135362832 CTGTGGGTGGTGGGCTGAGAGGG + Exonic
1033301133 7:140186853-140186875 CTGTGGTTGTTGATATAGTAGGG - Intergenic
1034452271 7:151143329-151143351 CTGTGGTTGCAGAGAGGAGAAGG + Exonic
1036183456 8:6604507-6604529 CTGTTGTTGTTGTTTTGAGACGG + Intronic
1036804950 8:11824738-11824760 CTGTTGTTGTTGTTTTGAGACGG + Intronic
1037187716 8:16084165-16084187 CTGTGATTTTAGAGATGTGATGG + Intergenic
1037448889 8:18997039-18997061 CTGAGATTGAAGAGATGAGAAGG - Intronic
1037529615 8:19759891-19759913 CTGGGGTTGCAGAGATGAGTTGG - Intergenic
1039624532 8:39034714-39034736 ATGTTGTTGTTGAGATGTCAAGG + Intronic
1039900818 8:41751497-41751519 CAGTGGCTGTTGAGCTGAGATGG + Intronic
1041677776 8:60553025-60553047 CTGTGCTTTTTGAGAGGTGATGG + Intronic
1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG + Intergenic
1044291369 8:90474662-90474684 CTGTGGTTGTCAAGATCACATGG - Intergenic
1044881915 8:96731715-96731737 CTGGGGGTGTTGAGGTGGGAAGG + Intronic
1046305982 8:112367610-112367632 TTGTGGTTGTGTAGATGAAATGG - Intronic
1046623098 8:116548452-116548474 ATGTGGTTGTTGGGAGGGGAAGG - Intergenic
1049049489 8:140183301-140183323 CTGGGGTTGTAGAGCTCAGAAGG - Intronic
1052836370 9:33252996-33253018 ATGAGGGGGTTGAGATGAGATGG + Exonic
1053189937 9:36055821-36055843 TTGTTGTTGTTGAGGGGAGATGG + Intronic
1053559184 9:39171598-39171620 CTGTGGCTGTGGACATGAGAAGG + Exonic
1053823302 9:41991839-41991861 CTGTGGCTGTGGACATGAGAAGG + Exonic
1054137927 9:61447348-61447370 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1054607271 9:67195526-67195548 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1054894178 9:70289040-70289062 TTGTTGTTGTTGTTATGAGACGG + Intronic
1055998182 9:82184738-82184760 CTGTTGTTTTGAAGATGAGAGGG + Intergenic
1057904907 9:98975798-98975820 CTGTGGATGTTTAGAGGAGGGGG + Intronic
1058506751 9:105674187-105674209 CTATGGTTGTAGATATGGGAAGG + Intergenic
1058673632 9:107381515-107381537 CTGTTGTTGTTGTTTTGAGATGG + Intergenic
1058879555 9:109274557-109274579 CTGTGGTTGCACAGATGAGCTGG - Intronic
1058927462 9:109681482-109681504 GTGGGGTTGTAGAGATGAAAAGG + Intronic
1061644250 9:131987336-131987358 CTGTAGATGTGGAGATGAGAAGG + Intronic
1186633928 X:11381464-11381486 CTATGGTCGTTGGGATGAAAGGG - Intronic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1190511865 X:51181357-51181379 CTATGGTTATTGAGATCACATGG + Intergenic
1191953487 X:66619494-66619516 CTTAGGTTGTGGAGGTGAGAGGG - Intronic
1195253860 X:103074951-103074973 CTGCAGTCGTTGAGATAAGATGG - Intergenic
1195260348 X:103125644-103125666 CTGTGTTTGTTTATTTGAGACGG + Intergenic
1195646405 X:107235632-107235654 CTGTGGTTGTAGACATCTGAAGG - Intronic
1195836392 X:109119401-109119423 CTGAGGGTGTTGAGATGTGATGG - Intergenic
1197261465 X:124323763-124323785 CTATGGATGATGTGATGAGATGG - Intronic
1198740784 X:139839968-139839990 TTATGGTTGTTGAGATCTGAAGG - Intronic
1199116990 X:144004472-144004494 CTGTGGTGGGTGGAATGAGATGG + Intergenic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic