ID: 1149151438

View in Genome Browser
Species Human (GRCh38)
Location 17:53569048-53569070
Sequence TTGAGTAAATGCAGCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149151438_1149151440 27 Left 1149151438 17:53569048-53569070 CCAGGTGTGCTGCATTTACTCAA No data
Right 1149151440 17:53569098-53569120 ACATATTATATTATGCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149151438 Original CRISPR TTGAGTAAATGCAGCACACC TGG (reversed) Intergenic
No off target data available for this crispr