ID: 1149154837

View in Genome Browser
Species Human (GRCh38)
Location 17:53615535-53615557
Sequence TTTCGTTATTCCCCTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149154836_1149154837 8 Left 1149154836 17:53615504-53615526 CCAGAAGAGGCATTTAAATGGCA No data
Right 1149154837 17:53615535-53615557 TTTCGTTATTCCCCTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149154837 Original CRISPR TTTCGTTATTCCCCTCCTAC AGG Intergenic
No off target data available for this crispr