ID: 1149160387

View in Genome Browser
Species Human (GRCh38)
Location 17:53686750-53686772
Sequence CTGGATGACAAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149160387_1149160389 2 Left 1149160387 17:53686750-53686772 CCTCTCTGCAGCTTGTCATCCAG No data
Right 1149160389 17:53686775-53686797 TCTCTACCCTCTTCCTTCTCTGG No data
1149160387_1149160393 23 Left 1149160387 17:53686750-53686772 CCTCTCTGCAGCTTGTCATCCAG No data
Right 1149160393 17:53686796-53686818 GGCCATCCTCTAACCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149160387 Original CRISPR CTGGATGACAAGCTGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr