ID: 1149165867

View in Genome Browser
Species Human (GRCh38)
Location 17:53751102-53751124
Sequence CCCCATCAAAACGTGCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149165867_1149165869 22 Left 1149165867 17:53751102-53751124 CCTTGGTGCACGTTTTGATGGGG No data
Right 1149165869 17:53751147-53751169 TTTAAGTTCCTTGTAGATTCTGG 0: 1749
1: 6291
2: 17928
3: 8944
4: 5647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149165867 Original CRISPR CCCCATCAAAACGTGCACCA AGG (reversed) Intergenic
No off target data available for this crispr