ID: 1149165958

View in Genome Browser
Species Human (GRCh38)
Location 17:53752272-53752294
Sequence TCTAACCCCCAAAATGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149165957_1149165958 0 Left 1149165957 17:53752249-53752271 CCAGTGCAGGAGGAGCTGGTGTG No data
Right 1149165958 17:53752272-53752294 TCTAACCCCCAAAATGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149165958 Original CRISPR TCTAACCCCCAAAATGTTCA AGG Intergenic
No off target data available for this crispr