ID: 1149166442

View in Genome Browser
Species Human (GRCh38)
Location 17:53758149-53758171
Sequence GTCCCTAAAAAAAGGCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149166437_1149166442 8 Left 1149166437 17:53758118-53758140 CCAAGGCTTCTTCTCAAGTCCTG No data
Right 1149166442 17:53758149-53758171 GTCCCTAAAAAAAGGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149166442 Original CRISPR GTCCCTAAAAAAAGGCATCC AGG Intergenic
No off target data available for this crispr