ID: 1149168130

View in Genome Browser
Species Human (GRCh38)
Location 17:53778762-53778784
Sequence CACTGTGGATGATGAGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149168123_1149168130 29 Left 1149168123 17:53778710-53778732 CCTTATGAGAACTCTGTCTGACG No data
Right 1149168130 17:53778762-53778784 CACTGTGGATGATGAGAATAGGG No data
1149168126_1149168130 4 Left 1149168126 17:53778735-53778757 CCATATATTAGGATTAGGAGTTC No data
Right 1149168130 17:53778762-53778784 CACTGTGGATGATGAGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149168130 Original CRISPR CACTGTGGATGATGAGAATA GGG Intergenic
No off target data available for this crispr