ID: 1149170498

View in Genome Browser
Species Human (GRCh38)
Location 17:53804257-53804279
Sequence AAAACTATTAAGTTAAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149170492_1149170498 23 Left 1149170492 17:53804211-53804233 CCCATAATGAGGTAAAGGATCTA No data
Right 1149170498 17:53804257-53804279 AAAACTATTAAGTTAAAAGAGGG No data
1149170493_1149170498 22 Left 1149170493 17:53804212-53804234 CCATAATGAGGTAAAGGATCTAG No data
Right 1149170498 17:53804257-53804279 AAAACTATTAAGTTAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149170498 Original CRISPR AAAACTATTAAGTTAAAAGA GGG Intergenic
No off target data available for this crispr