ID: 1149186417

View in Genome Browser
Species Human (GRCh38)
Location 17:54002993-54003015
Sequence GGTTTGTCTTTTAAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149186413_1149186417 3 Left 1149186413 17:54002967-54002989 CCTTTTAGTTTTCTCTTCATTAT No data
Right 1149186417 17:54002993-54003015 GGTTTGTCTTTTAAGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149186417 Original CRISPR GGTTTGTCTTTTAAGTTGGT GGG Intergenic
No off target data available for this crispr