ID: 1149188432

View in Genome Browser
Species Human (GRCh38)
Location 17:54029907-54029929
Sequence TGCACCACAGGGCCACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149188432_1149188435 22 Left 1149188432 17:54029907-54029929 CCTGGCAGTGGCCCTGTGGTGCA No data
Right 1149188435 17:54029952-54029974 GAGAGAGAGCACAGTGATTGTGG No data
1149188432_1149188436 23 Left 1149188432 17:54029907-54029929 CCTGGCAGTGGCCCTGTGGTGCA No data
Right 1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149188432 Original CRISPR TGCACCACAGGGCCACTGCC AGG (reversed) Intergenic
No off target data available for this crispr