ID: 1149188433

View in Genome Browser
Species Human (GRCh38)
Location 17:54029918-54029940
Sequence CATATTTTCTCTGCACCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149188433_1149188435 11 Left 1149188433 17:54029918-54029940 CCCTGTGGTGCAGAGAAAATATG No data
Right 1149188435 17:54029952-54029974 GAGAGAGAGCACAGTGATTGTGG No data
1149188433_1149188436 12 Left 1149188433 17:54029918-54029940 CCCTGTGGTGCAGAGAAAATATG No data
Right 1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149188433 Original CRISPR CATATTTTCTCTGCACCACA GGG (reversed) Intergenic
No off target data available for this crispr