ID: 1149188436

View in Genome Browser
Species Human (GRCh38)
Location 17:54029953-54029975
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149188434_1149188436 11 Left 1149188434 17:54029919-54029941 CCTGTGGTGCAGAGAAAATATGT No data
Right 1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG No data
1149188433_1149188436 12 Left 1149188433 17:54029918-54029940 CCCTGTGGTGCAGAGAAAATATG No data
Right 1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG No data
1149188430_1149188436 30 Left 1149188430 17:54029900-54029922 CCGACTACCTGGCAGTGGCCCTG No data
Right 1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG No data
1149188432_1149188436 23 Left 1149188432 17:54029907-54029929 CCTGGCAGTGGCCCTGTGGTGCA No data
Right 1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149188436 Original CRISPR AGAGAGAGCACAGTGATTGT GGG Intergenic