ID: 1149189775

View in Genome Browser
Species Human (GRCh38)
Location 17:54046777-54046799
Sequence TAAACTAGGCAGGATGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149189772_1149189775 14 Left 1149189772 17:54046740-54046762 CCAATTTATTATTGAGAATGTGA No data
Right 1149189775 17:54046777-54046799 TAAACTAGGCAGGATGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149189775 Original CRISPR TAAACTAGGCAGGATGTAAC TGG Intergenic
No off target data available for this crispr