ID: 1149195990

View in Genome Browser
Species Human (GRCh38)
Location 17:54121938-54121960
Sequence TATTAGGTAGAGTACTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149195990_1149195997 22 Left 1149195990 17:54121938-54121960 CCCTCAAAGTACTCTACCTAATA No data
Right 1149195997 17:54121983-54122005 AGTCTGGCTGGTAGAAATACTGG No data
1149195990_1149195995 6 Left 1149195990 17:54121938-54121960 CCCTCAAAGTACTCTACCTAATA No data
Right 1149195995 17:54121967-54121989 GATAAATAAGATTCTCAGTCTGG No data
1149195990_1149195996 10 Left 1149195990 17:54121938-54121960 CCCTCAAAGTACTCTACCTAATA No data
Right 1149195996 17:54121971-54121993 AATAAGATTCTCAGTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149195990 Original CRISPR TATTAGGTAGAGTACTTTGA GGG (reversed) Intergenic
No off target data available for this crispr