ID: 1149198803

View in Genome Browser
Species Human (GRCh38)
Location 17:54157798-54157820
Sequence GTGTGGAAGTAGAAAAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149198801_1149198803 1 Left 1149198801 17:54157774-54157796 CCATTAAGAAAACGTAATGAGAA No data
Right 1149198803 17:54157798-54157820 GTGTGGAAGTAGAAAAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149198803 Original CRISPR GTGTGGAAGTAGAAAAATGA AGG Intergenic
No off target data available for this crispr