ID: 1149200089

View in Genome Browser
Species Human (GRCh38)
Location 17:54175425-54175447
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149200089_1149200094 10 Left 1149200089 17:54175425-54175447 CCAGGAGTCCAGGCATGTGATTG No data
Right 1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG No data
1149200089_1149200093 3 Left 1149200089 17:54175425-54175447 CCAGGAGTCCAGGCATGTGATTG No data
Right 1149200093 17:54175451-54175473 CTAACTGGTGGAAGCACAGATGG No data
1149200089_1149200092 -9 Left 1149200089 17:54175425-54175447 CCAGGAGTCCAGGCATGTGATTG No data
Right 1149200092 17:54175439-54175461 ATGTGATTGAGACTAACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149200089 Original CRISPR CAATCACATGCCTGGACTCC TGG (reversed) Intergenic
No off target data available for this crispr