ID: 1149200089 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:54175425-54175447 |
Sequence | CAATCACATGCCTGGACTCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1149200089_1149200094 | 10 | Left | 1149200089 | 17:54175425-54175447 | CCAGGAGTCCAGGCATGTGATTG | No data | ||
Right | 1149200094 | 17:54175458-54175480 | GTGGAAGCACAGATGGAGAAAGG | No data | ||||
1149200089_1149200093 | 3 | Left | 1149200089 | 17:54175425-54175447 | CCAGGAGTCCAGGCATGTGATTG | No data | ||
Right | 1149200093 | 17:54175451-54175473 | CTAACTGGTGGAAGCACAGATGG | No data | ||||
1149200089_1149200092 | -9 | Left | 1149200089 | 17:54175425-54175447 | CCAGGAGTCCAGGCATGTGATTG | No data | ||
Right | 1149200092 | 17:54175439-54175461 | ATGTGATTGAGACTAACTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1149200089 | Original CRISPR | CAATCACATGCCTGGACTCC TGG (reversed) | Intergenic | ||
No off target data available for this crispr |