ID: 1149200090

View in Genome Browser
Species Human (GRCh38)
Location 17:54175433-54175455
Sequence GTTAGTCTCAATCACATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149200090_1149200094 2 Left 1149200090 17:54175433-54175455 CCAGGCATGTGATTGAGACTAAC No data
Right 1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG No data
1149200090_1149200093 -5 Left 1149200090 17:54175433-54175455 CCAGGCATGTGATTGAGACTAAC No data
Right 1149200093 17:54175451-54175473 CTAACTGGTGGAAGCACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149200090 Original CRISPR GTTAGTCTCAATCACATGCC TGG (reversed) Intergenic
No off target data available for this crispr