ID: 1149200094

View in Genome Browser
Species Human (GRCh38)
Location 17:54175458-54175480
Sequence GTGGAAGCACAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149200089_1149200094 10 Left 1149200089 17:54175425-54175447 CCAGGAGTCCAGGCATGTGATTG No data
Right 1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG No data
1149200090_1149200094 2 Left 1149200090 17:54175433-54175455 CCAGGCATGTGATTGAGACTAAC No data
Right 1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149200094 Original CRISPR GTGGAAGCACAGATGGAGAA AGG Intergenic
No off target data available for this crispr