ID: 1149204522

View in Genome Browser
Species Human (GRCh38)
Location 17:54228212-54228234
Sequence CTCCAGTAGGGACTCCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149204522_1149204528 3 Left 1149204522 17:54228212-54228234 CCCACATGGAGTCCCTACTGGAG No data
Right 1149204528 17:54228238-54228260 CGCCTAGTGGAGCTGTGAGAAGG No data
1149204522_1149204529 4 Left 1149204522 17:54228212-54228234 CCCACATGGAGTCCCTACTGGAG No data
Right 1149204529 17:54228239-54228261 GCCTAGTGGAGCTGTGAGAAGGG 0: 62
1: 127
2: 186
3: 190
4: 305
1149204522_1149204526 -10 Left 1149204522 17:54228212-54228234 CCCACATGGAGTCCCTACTGGAG No data
Right 1149204526 17:54228225-54228247 CCTACTGGAGCACCGCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149204522 Original CRISPR CTCCAGTAGGGACTCCATGT GGG (reversed) Intergenic
No off target data available for this crispr