ID: 1149205749

View in Genome Browser
Species Human (GRCh38)
Location 17:54244595-54244617
Sequence TAAAATGAACATAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149205744_1149205749 -2 Left 1149205744 17:54244574-54244596 CCAATCAGAATCTTTTGCTGTTA No data
Right 1149205749 17:54244595-54244617 TAAAATGAACATAATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149205749 Original CRISPR TAAAATGAACATAATGGGGA GGG Intergenic
No off target data available for this crispr