ID: 1149214514

View in Genome Browser
Species Human (GRCh38)
Location 17:54338297-54338319
Sequence CAATGCAGAAAGTTTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149214514_1149214517 24 Left 1149214514 17:54338297-54338319 CCCAGCTCAAACTTTCTGCATTG No data
Right 1149214517 17:54338344-54338366 TTCATTCAATTTATTCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149214514 Original CRISPR CAATGCAGAAAGTTTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr