ID: 1149218011

View in Genome Browser
Species Human (GRCh38)
Location 17:54380945-54380967
Sequence GGCCCTCTGCTTCATCTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149218008_1149218011 26 Left 1149218008 17:54380896-54380918 CCATGAAACAAAAATTACTGCAT No data
Right 1149218011 17:54380945-54380967 GGCCCTCTGCTTCATCTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149218011 Original CRISPR GGCCCTCTGCTTCATCTCAC GGG Intergenic
No off target data available for this crispr