ID: 1149218973

View in Genome Browser
Species Human (GRCh38)
Location 17:54392832-54392854
Sequence TGGTCGTGTTCTCATGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149218973_1149218980 9 Left 1149218973 17:54392832-54392854 CCACTGCCATGAGAACACGACCA No data
Right 1149218980 17:54392864-54392886 GATGAATATGAAAAATGCATGGG No data
1149218973_1149218979 8 Left 1149218973 17:54392832-54392854 CCACTGCCATGAGAACACGACCA No data
Right 1149218979 17:54392863-54392885 TGATGAATATGAAAAATGCATGG No data
1149218973_1149218981 16 Left 1149218973 17:54392832-54392854 CCACTGCCATGAGAACACGACCA No data
Right 1149218981 17:54392871-54392893 ATGAAAAATGCATGGGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149218973 Original CRISPR TGGTCGTGTTCTCATGGCAG TGG (reversed) Intergenic